After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano BNIP3L clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human BNIP3L Información de producto de clon de cDNA
Tamaño de cDNA:
Descripción de cDNA:
Sinónimo de gen:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Human BNIP3L Gene Plasmid Map
Human BNIP3L Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Imazu T, et al. (1999) Bcl-2 / E1B 19 kDa-interacting protein 3-like protein (Bnip3L) interacts with bcl-2 / Bcl-xL and induces apoptosis by altering mitochondrial membrane permeability. Oncogene. 18(32): 4523-9.
  • Sun JL, et al. (2004) Expression and structure of BNIP3L in lung cancer. Ai Zheng. 23(1): 8-14.
  • Contact Us
    • Human BNIP3L Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.