Pedido rápido

Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Canino ALDOC Información de producto de clon de cDNA
    Tamaño de cDNA:1095bp
    Descripción de cDNA:Full length Clone DNA of Canis lupus familiaris aldolase C, fructose-bisphosphate with C terminal His tag.
    Sinónimo de gen:ALDOC
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaDG70204-ACG$225
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaDG70204-ACR$225
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaDG70204-ANG$225
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaDG70204-ANR$225
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaDG70204-CF$195
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaDG70204-CH$195
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaDG70204-CM$195
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaDG70204-CY$195
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaDG70204-NF$195
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaDG70204-NH$195
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaDG70204-NM$195
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaDG70204-NY$195
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(Vector de expresión)DG70204-U$75
    Canino Aldolase C/ALDOC clonación del ADN o clonación génica(vector de clonación)DG70204-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.