Pedido rápido

Text Size:AAA

Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Canine C12H6orf57 Información de producto de clon de cDNA
Tamaño de cDNA:324bp
Descripción de cDNA:Full length Clone DNA of Canis lupus familiaris chromosome 12 open reading frame, human C6orf57 with C terminal His tag.
Sinónimo de gen:C12H6orf57
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaDG70195-ACG$225
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaDG70195-ACR$225
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaDG70195-ANG$225
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaDG70195-ANR$225
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaDG70195-CF$195
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaDG70195-CH$195
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaDG70195-CM$195
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaDG70195-CY$195
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaDG70195-NF$195
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaDG70195-NH$195
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaDG70195-NM$195
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaDG70195-NY$195
Canino C12H6orf57 clonación del ADN o clonación génica(Vector de expresión)DG70195-U$75
Canino C12H6orf57 clonación del ADN o clonación génica(vector de clonación)DG70195-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: DG70195-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.