Pedido rápido

Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Canino DPYS Información de producto de clon de cDNA
    Gene_bank_ref_id:XM_003639441.1
    Tamaño de cDNA:1557bp
    Descripción de cDNA:Full length Clone DNA of Canis lupus familiaris dihydropyrimidinase-like with C terminal Flag tag.
    Sinónimo de gen:DPYS
    Especie:Canine
    Vector:pCMV3-C-FLAG
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaDG70036-ACG$245
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaDG70036-ACR$245
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaDG70036-ANG$245
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaDG70036-ANR$245
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaDG70036-CF$215
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaDG70036-CH$215
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaDG70036-CM$215
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaDG70036-CY$215
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(Vector de expresión)DG70036-G$75
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaDG70036-NF$215
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaDG70036-NH$215
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaDG70036-NM$215
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaDG70036-NY$215
    Canino DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación)DG70036-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

    Referencias
  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
  • Size / Price
    Catálogo: DG70036-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"