After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Canine GABARAPL2 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005620674.1
Tamaño de cDNA:354bp
Descripción de cDNA:Full length Clone DNA of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 with C terminal His tag.
Sinónimo de gen:GABARAPL2
Especie:Canine
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaDG70191-ACG$225
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaDG70191-ACR$225
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaDG70191-ANG$225
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaDG70191-ANR$225
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaDG70191-CF$195
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaDG70191-CH$195
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaDG70191-CM$195
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaDG70191-CY$195
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaDG70191-NF$195
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaDG70191-NH$195
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaDG70191-NM$195
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaDG70191-NY$195
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(Vector de expresión)DG70191-U$75
Canino GATE-16 / GABARAPL2 clonación del ADN o clonación génica(vector de clonación)DG70191-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

Referencias
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Catálogo: DG70191-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"