IL20RA cDNA ORF Clone, Canine, C-Myc tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

IL20RA cDNA ORF Clone, Canine, C-Myc tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1572 bp
Description
Full length Clone DNA of Canine interleukin 20 receptor, alpha with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL20RA Background Information

Interleukin 2 receptor, alpha subunit (IL2RA/IL-2RA) also known as IL-2 receptor subunit alpha, Cytokine receptor class-II member 8, interleukin-2 receptor I, and interleukin-2 receptor subunit alpha, is a subunit for the interleukin-2 receptor. IL2RA/IL-2RA belongs to the type II cytokine receptor family. This cytokine is a receptor for interleukin 2 (IL2), a cytokine that may be involved in epidermal function. The receptor of IL2 is a heterodimeric receptor complex consisting of this protein and interleukin 2 receptor beta (IL2B). IL2RA forms heterodimer with IL2RB, and the complex serves as a receptor for IL19, IL2 and IL24. All three are capable of signaling through IL-2RA/IL-2RB complex. The ligand binding to receptor B creating a high-affinity binding site for the receptor A which is recruited to complete the complex. In addition, IL2RA also forms a heterodimer with the unique and specific receptor IL1RB and functions as the receptor for IL26. IL2RA is widely expressed with highest levels in skin, testis and brain. The expression of both IL2RA and IL2RB is found to be upregulated in psoriatic skin lesions on keratinocytes.
Full Name
interleukin 20 receptor, alpha
References
  • Parrish-Novak J, et al. (2002) Interleukins 19, 20, and 24 signal through two distinct receptor complexes. Differences in receptor-ligand interactions mediate unique biological functions. J Biol Chem. 277(49): 47517-23.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5): 445-51.
  • Blumberg H, et al. (2001) Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell. 104(1): 9-19.

IL20RA cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait