IL25 cDNA ORF Clone, Canine, N-DDK (Flag®) tag

Price:
Size:
Number:

IL25 cDNA ORF Clone, Canine, N-DDK (Flag®) tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
510 bp
Description
Full length Clone DNA of Canine interleukin 25 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL25 Background Information

Interleukin-25 (IL-25) is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. IL-25 is a member of the IL-17 family of cytokines. However, unlike the other members of this family, IL-25 promotes T helper (Th) 2 responses. IL-25 also regulates the development of autoimmune inflammation mediated by IL-17–producing T cells. IL-25 and IL-17, being members of the same cytokine family, play opposing roles in the pathogenesis of organ-specific autoimmunity. IL-25 promotes cell expansion and Th2 cytokine production when Th2 central memory cells are stimulated with thymic stromal lymphopoietin (TSLP)–activated dendritic cells (DCs), homeostatic cytokines, or T cell receptor for antigen triggering. Elevated expression of IL-25 and IL-25R transcripts was observed in asthmatic lung tissues and atopic dermatitis skin lesions, linking their possible roles with exacerbated allergic disorders. A plausible explanation that IL-25 produced by innate effector eosinophils and basophils may augment the allergic inflammation by enhancing the maintenance and functions of adaptive Th2 memory cells had been provided.
Full Name
interleukin 25
References
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Tamachi T, et al.. (2006) IL-25 enhances allergic airway inflammation by amplifying a TH2 cell-dependent pathway in mice. J Allergy Clin Immunol. 118(3): 606-14.
  • Kleinschek MA, et al.. (2007) IL-25 regulates Th17 function in autoimmune inflammation. J Exp Med. 204(1): 161-70.

IL25 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait