Pedido rápido

Text Size:AAA

Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Canine MAP1LC3B Información de producto de clon de cDNA
Tamaño de cDNA:378bp
Descripción de cDNA:Full length Clone DNA of Canis lupus familiaris microtubule-associated protein 1 light chain 3 beta with C terminal His tag.
Sinónimo de gen:MAP1LC3B
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaDG70200-ACG$225
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaDG70200-ACR$225
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaDG70200-ANG$225
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaDG70200-ANR$225
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaDG70200-CF$195
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaDG70200-CH$195
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaDG70200-CM$195
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaDG70200-CY$195
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaDG70200-NF$195
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaDG70200-NH$195
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaDG70200-NM$195
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaDG70200-NY$195
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(Vector de expresión)DG70200-U$75
Canino LC3B / MAP1LC3B clonación del ADN o clonación génica(vector de clonación)DG70200-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

LC3B, also known as MAP1LC3B, is a member of the MAP1 LC3 family. It is moat abundantly expressed in heart, brain, skeletal muscle and testis. LC3B is a subunit of neuronal microtubule and functions in formation of autophagosomal vacuoles (autophagosomes). It associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. LC3B also plays a role in autophagy, a process that involves the bulk degradation of cytoplasmic component.

  • Behrends C. et al., 2010, Nature. 466 (7302): 68-76.
  • Tanida I. et al., 2005, Int J Biochem Cell Biol. 36 (12): 2503-18.
  • Kabeya Y. et al., 2000, EMBO J. 19 (21): 5720-8.
  • Cherra SJ. et al., 2010, J Cell Biol. 190 (4): 533-9.
  • Size / Price
    Catálogo: DG70200-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.