Pedido rápido

Text Size:AAA

Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Canine MRPS33 Información de producto de clon de cDNA
Tamaño de cDNA:321bp
Descripción de cDNA:Full length Clone DNA of Canis lupus familiaris mitochondrial ribosomal protein S33 with C terminal His tag.
Sinónimo de gen:MRPS33
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaDG70221-ACG$225
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaDG70221-ACR$225
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaDG70221-ANG$225
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaDG70221-ANR$225
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaDG70221-CF$195
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaDG70221-CH$195
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaDG70221-CM$195
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaDG70221-CY$195
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaDG70221-NF$195
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaDG70221-NH$195
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaDG70221-NM$195
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaDG70221-NY$195
Canino MRPS33 clonación del ADN o clonación génica(Vector de expresión)DG70221-U$75
Canino MRPS33 clonación del ADN o clonación génica(vector de clonación)DG70221-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: DG70221-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.