Pedido rápido

Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Canino TUBA1A Información de producto de clon de cDNA
    Tamaño de cDNA:1356bp
    Descripción de cDNA:Full length Clone DNA of Canis lupus familiaris tubulin, alpha 1a with C terminal His tag.
    Sinónimo de gen:TUBA1A
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaDG70199-ACG$225
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaDG70199-ACR$225
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaDG70199-ANG$225
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaDG70199-ANR$225
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaDG70199-CF$195
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaDG70199-CH$195
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaDG70199-CM$195
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaDG70199-CY$195
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaDG70199-NF$195
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaDG70199-NH$195
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaDG70199-NM$195
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaDG70199-NY$195
    Canino TUBA1A clonación del ADN o clonación génica(Vector de expresión)DG70199-U$75
    Canino TUBA1A clonación del ADN o clonación génica(vector de clonación)DG70199-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: DG70199-CH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.