Pedido rápido

Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rhesus ACO2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001261164.2
    Tamaño de cDNA:2343bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) aconitase 2, mitochondrial with N terminal His tag.
    Sinónimo de gen:ACO2
    Especie:Rhesus
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90615-ACG$245
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90615-ACR$245
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90615-ANG$245
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90615-ANR$245
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90615-CF$215
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90615-CH$215
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90615-CM$215
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90615-CY$215
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(Vector de expresión)CG90615-G$75
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90615-NF$215
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90615-NH$215
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90615-NM$215
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90615-NY$215
    Rhesus ACO2 / Aconitase 2 clonación del ADN o clonación génica(vector de clonación)CG90615-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Referencias
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins. 5 (4): 289-312.
  • Lauble H, et al. (1992) Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry. 31 (10): 2735-48.
  • Robbins AH, et al. (1989) Structure of activated aconitase: formation of the 4Fe-4S cluster in the crystal. Proc Natl Acad Sci. 86 (10): 3639-43.
  • Size / Price
    Catálogo: CG90615-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"