Pedido rápido

Text Size:AAA

Rhesus ACO2 ORF mammalian expression plasmid, N-His tag

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus ACO2 Información de producto de clon de cDNA
Tamaño de cDNA:2343bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) aconitase 2, mitochondrial with N terminal His tag.
Sinónimo de gen:ACO2
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins. 5 (4): 289-312.
  • Lauble H, et al. (1992) Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry. 31 (10): 2735-48.
  • Robbins AH, et al. (1989) Structure of activated aconitase: formation of the 4Fe-4S cluster in the crystal. Proc Natl Acad Sci. 86 (10): 3639-43.
  • Size / Price
    Catálogo: CG90615-NH
    Precio de lista:   (Save )
    Precio:      [How to order]
     Instrucciones de envío
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.