Pedido rápido

Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero AGPAT4 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001283744.
    Tamaño de cDNA:1137bp
    Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) 1-acyl-sn-glycerol-3-phosphate acyltransferase delta with N terminal Myc tag.
    Sinónimo de gen:AGPAT4
    Especie:Cynomolgus
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90655-ACG$225
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90655-ACR$225
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90655-CF$195
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90655-CH$195
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90655-CM$195
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90655-CY$195
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(Vector de expresión)CG90655-G$75
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90655-NF$195
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90655-NH$195
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90655-NM$195
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90655-NY$195
    Cangrejero 1-AGP acyltransferase 4/AGPAT4 clonación del ADN o clonación génica(vector de clonación)CG90655-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: CG90655-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"