Pedido rápido

Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero APEX1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001258109.1
    Tamaño de cDNA:957bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) APEX nuclease (multifunctional DNA repair enzyme) 1 with N terminal Flag tag.
    Sinónimo de gen:APEX1
    Especie:Rhesus
    Vector:pCMV3-N-FLAG
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90434-ACG$225
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90434-ACR$225
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90434-ANG$225
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90434-ANR$225
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90434-CF$195
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90434-CH$195
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90434-CM$195
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90434-CY$195
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(Vector de expresión)CG90434-G$75
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90434-NF$195
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90434-NH$195
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90434-NM$195
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90434-NY$195
    Rhesus APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación)CG90434-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

    Referencias
  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    Catálogo: CG90434-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"