Pedido rápido

Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero ARF3 Información de producto de clon de cDNA
    Gene_bank_ref_id:XM_005570735.1
    Tamaño de cDNA:546bp
    Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosylation factor 3.
    Sinónimo de gen:ARF3
    Especie:Cynomolgus
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90751-ACG$225
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90751-ACR$225
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90751-CF$195
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90751-CH$195
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90751-CM$195
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90751-CY$195
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(Vector de expresión)CG90751-G$75
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90751-NF$195
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90751-NH$195
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90751-NM$195
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90751-NY$195
    Cangrejero ARF3 / ADP-ribosylation factor 3 clonación del ADN o clonación génica(vector de clonación)CG90751-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

    Referencias
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • Size / Price
    Catálogo: CG90751-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"