Pedido rápido

Text Size:AAA

Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus ARMCX2 Información de producto de clon de cDNA
Tamaño de cDNA:1899bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) armadillo repeat containing, X-linked 2 with C terminal His tag.
Sinónimo de gen:ARMCX2
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90827-ACG$245
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90827-ACR$245
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90827-ANG$245
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90827-ANR$245
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90827-CF$215
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90827-CH$215
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90827-CM$215
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90827-CY$215
Rhesus ARMCX2 clonación del ADN o clonación génica(Vector de expresión)CG90827-G$75
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90827-NF$215
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90827-NH$215
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90827-NM$215
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90827-NY$215
Rhesus ARMCX2 clonación del ADN o clonación génica(vector de clonación)CG90827-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90827-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.