ATP5F1 cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90552-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ATP5F1 Reagents

CRO Services

Product recommended


All ATP5F1 Reagents

ATP5F1 cDNA ORF Clone, Rhesus, C-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
771 bp
Description
Full length Clone DNA of Rhesus ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5F1 Background Information

Full Name
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1

ATP5F1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ATP5F1 cDNA ORF Clone in Cloning Vector, Rhesus CG90552-U
ATP5F1 cDNA ORF Clone, Rhesus, untagged CG90552-UT
ATP5F1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90552-ACG
ATP5F1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90552-ACGLN
ATP5F1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90552-ANG
ATP5F1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90552-ACR
ATP5F1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90552-ANR
ATP5F1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90552-CF
ATP5F1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90552-NF
ATP5F1 cDNA ORF Clone, Rhesus, C-His tag CG90552-CH
ATP5F1 cDNA ORF Clone, Rhesus, N-His tag CG90552-NH
ATP5F1 cDNA ORF Clone, Rhesus, N-HA tag CG90552-NY
ATP5F1 cDNA ORF Clone, Rhesus, C-Myc tag CG90552-CM
ATP5F1 cDNA ORF Clone, Rhesus, N-Myc tag CG90552-NM

ATP5F1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP5F1 cDNA ORF Clone in Cloning Vector, Rat RG81638-G
ATP5F1 cDNA ORF Clone, Rat, untagged RG81638-UT
ATP5F1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81638-ACG
ATP5F1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81638-ACGLN
ATP5F1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81638-ANG
ATP5F1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81638-ACR
ATP5F1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81638-ANR
ATP5F1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81638-CF
ATP5F1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81638-NF
ATP5F1 cDNA ORF Clone, Rat, C-His tag RG81638-CH
ATP5F1 cDNA ORF Clone, Rat, N-His tag RG81638-NH
ATP5F1 cDNA ORF Clone, Rat, C-HA tag RG81638-CY
ATP5F1 cDNA ORF Clone, Rat, N-HA tag RG81638-NY
ATP5F1 cDNA ORF Clone, Rat, C-Myc tag RG81638-CM
ATP5F1 cDNA ORF Clone, Rat, N-Myc tag RG81638-NM

ATP5F1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP5F1 cDNA ORF Clone in Cloning Vector, Mouse MG53631-U
ATP5F1 cDNA ORF Clone, Mouse, untagged MG53631-UT
ATP5F1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53631-ACGLN
ATP5F1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53631-ACG
ATP5F1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53631-ANG
ATP5F1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53631-ACR
ATP5F1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53631-ANR
ATP5F1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53631-CF
ATP5F1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53631-NF
ATP5F1 cDNA ORF Clone, Mouse, C-His tag MG53631-CH
ATP5F1 cDNA ORF Clone, Mouse, N-His tag MG53631-NH
ATP5F1 cDNA ORF Clone, Mouse, C-HA tag MG53631-CY
ATP5F1 cDNA ORF Clone, Mouse, N-HA tag MG53631-NY
ATP5F1 cDNA ORF Clone, Mouse, C-Myc tag MG53631-CM
ATP5F1 cDNA ORF Clone, Mouse, N-Myc tag MG53631-NM

ATP5F1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP5F1 cDNA ORF Clone in Cloning Vector, Human HG14249-G
ATP5F1 cDNA ORF Clone, Human, untagged HG14249-UT
ATP5F1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14249-ACGLN
ATP5F1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14249-ACG
ATP5F1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14249-ANG
ATP5F1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14249-ACR
ATP5F1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14249-ANR
ATP5F1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14249-CF
ATP5F1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14249-NF
ATP5F1 cDNA ORF Clone, Human, C-His tag HG14249-CH
ATP5F1 cDNA ORF Clone, Human, N-His tag HG14249-NH
ATP5F1 cDNA ORF Clone, Human, C-HA tag HG14249-CY
ATP5F1 cDNA ORF Clone, Human, N-HA tag HG14249-NY
ATP5F1 cDNA ORF Clone, Human, C-Myc tag HG14249-CM
ATP5F1 cDNA ORF Clone, Human, N-Myc tag HG14249-NM
ATP5F1 qPCR Primer Pairs, Human HP102899
info info
添加购物车成功! 添加购物车失败!