Pedido rápido

Cynomolgus monkey BRK1 ORF mammalian expression plasmid, C-His tag

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus BRK1 Información de producto de clon de cDNA
Tamaño de cDNA:228bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) BRICK1, SCAR>WAVE actin-nucleating complex subunit with C terminal His tag.
Sinónimo de gen:BRK1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catálogo: CG90816-CH
Precio de lista:   (Save )
Precio:      [How to order]
Disponibilidad2-3 weeksInstrucciones de envío
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.