Pedido rápido

Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero BTBD10 Información de producto de clon de cDNA
    Gene_bank_ref_id:XM_005578582.1
    Tamaño de cDNA:1452bp
    Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) BTB (POZ) domain containing 10 with N terminal His tag.
    Sinónimo de gen:BTBD10
    Especie:Cynomolgus
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90616-ACG$225
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90616-ACR$225
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90616-ANG$225
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90616-ANR$225
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90616-CF$195
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90616-CH$195
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90616-CM$195
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90616-CY$195
    Cangrejero BTBD10 clonación del ADN o clonación génica(Vector de expresión)CG90616-G$75
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90616-NF$195
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90616-NH$195
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90616-NM$195
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90616-NY$195
    Cangrejero BTBD10 clonación del ADN o clonación génica(vector de clonación)CG90616-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: CG90616-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"