After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus CD5 Información de producto de clon de cDNA
Tamaño de cDNA:1406bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD5 molecule with C terminal Flag tag.
Sinónimo de gen:CD5
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90176-ACG$225
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90176-ACR$225
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90176-CF$195
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90176-CH$195
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90176-CM$195
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90176-CY$195
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(Vector de expresión)CG90176-G$75
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90176-NF$195
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90176-NH$195
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90176-NM$195
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90176-NY$195
Rhesus CD5 / Cluster of Differentiation 5 clonación del ADN o clonación génica(vector de clonación)CG90176-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD5 is a member of the CD system. CD5 was found to be widely distributed in T-cells and B1 cells which is a subset of IgM-secreting B cells. CD5 also was found expressed in small lymphocytic lymphoma, hairy cell leukaemia and mantle cell lymphoma cells. CD5 serves to weaken the activating stimulus from the BCR so that the B1 cells can only reflect to the very strong stimuli but not the normal tissue proteins.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters. 134 (2): 104-12.
  • Kirchgessner H, et al. (2001) The transmembrane adaptor protein TRIM regulates T cell receptor (TCR) expression and TCR-mediated signaling via an association with the TCR zeta chain. J Exp Med. 193 (11): 1269-84.
  • Size / Price
    Catálogo: CG90176-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.