Pedido rápido

Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero CDC40 Información de producto de clon de cDNA
    Tamaño de cDNA:1740bp
    Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) cell division cycle 40 with N terminal Myc tag.
    Sinónimo de gen:CDC40
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90673-ACG$245
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90673-ACR$245
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90673-ANG$245
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90673-ANR$245
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90673-CF$215
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90673-CH$215
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90673-CM$215
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90673-CY$215
    Cangrejero CDC40 clonación del ADN o clonación génica(Vector de expresión)CG90673-G$75
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90673-NF$215
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90673-NH$215
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90673-NM$215
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90673-NY$215
    Cangrejero CDC40 clonación del ADN o clonación génica(vector de clonación)CG90673-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: CG90673-NM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.