After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus CDK5RAP3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001261645.1
Tamaño de cDNA:1521bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CDK5 regulatory subunit associated protein 3.
Sinónimo de gen:CDK5RAP3
Especie:Rhesus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación) on other vectors
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90734-ACG$245
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90734-ACR$245
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90734-ANG$245
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90734-ANR$245
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90734-CF$215
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90734-CH$215
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90734-CM$215
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90734-CY$215
Rhesus CDK5RAP3 clonación del ADN o clonación génica(Vector de expresión)CG90734-G$75
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90734-NF$215
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90734-NH$215
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90734-NM$215
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90734-NY$215
Rhesus CDK5RAP3 clonación del ADN o clonación génica(vector de clonación)CG90734-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90734-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"