Pedido rápido

Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus CHN1 Información de producto de clon de cDNA
Tamaño de cDNA:1005bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chimerin 1 with C terminal His tag.
Sinónimo de gen:CHN1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90836-ACG$225
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90836-ACR$225
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90836-ANG$225
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90836-ANR$225
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90836-CF$195
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90836-CH$195
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90836-CM$195
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90836-CY$195
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(Vector de expresión)CG90836-G$75
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90836-NF$195
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90836-NH$195
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90836-NM$195
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90836-NY$195
Cangrejero CHN1 / chimerin 1 clonación del ADN o clonación génica(vector de clonación)CG90836-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • Size / Price
    Catálogo: CG90836-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.