Pedido rápido

Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero COPS5 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001260680.1
    Tamaño de cDNA:1005bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis).
    Sinónimo de gen:COPS5
    Especie:Rhesus
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90742-ACG$225
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90742-ACR$225
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90742-ANG$225
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90742-ANR$225
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90742-CF$195
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90742-CH$195
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90742-CM$195
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90742-CY$195
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(Vector de expresión)CG90742-G$75
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90742-NF$195
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90742-NH$195
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90742-NM$195
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90742-NY$195
    Rhesus JAB1/CSN5 clonación del ADN o clonación génica(vector de clonación)CG90742-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"