Pedido rápido

Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero CRP Información de producto de clon de cDNA
    Gene_bank_ref_id:XM_001117250.2
    Tamaño de cDNA:675bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) C-reactive protein, pentraxin-related with N terminal Myc tag.
    Sinónimo de gen:CRP
    Especie:Rhesus
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90002-ACG$225
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90002-ACR$225
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90002-CF$195
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90002-CH$195
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90002-CM$195
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90002-CY$195
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(Vector de expresión)CG90002-G$75
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90002-NF$195
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90002-NH$195
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90002-NM$195
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90002-NY$195
    Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación)CG90002-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is a member of the pentraxin family of proteins. The levels of CRP rise in response to inflammation. Human C-reactive protein (CRP) is the classical acute phase reactant, the circulating concentration of which rises rapidly and extensively in a cytokine-mediated response to tissue injury, infection and inflammation. Serum CRP values are routinely measured, empirically, to detect and monitor many human diseases. However, CRP is likely to have important host defence, scavenging and metabolic functions through its capacity for calcium-dependent binding to exogenous and autologous molecules containing phosphocholine (PC) and then activating the classical complement pathway. CRP may also have pathogenic effects and the recent discovery of a prognostic association between increased CRP production and coronary atherothrombotic events is of particular interest.

    Referencias
  • Pepys MB. et al., 2003, J Clin Invest. 111 (12): 1805-12.
  • Thompson D. et al., 1999, Structure. 7(2): 169-77.
  • Size / Price
    Catálogo: CG90002-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"