After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus CRP Información de producto de clon de cDNA
Gene_bank_ref_id:XM_001117250.2
Tamaño de cDNA:675bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) C-reactive protein, pentraxin-related with N terminal Myc tag.
Sinónimo de gen:CRP
Especie:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90002-ACG$225
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90002-ACR$225
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90002-CF$195
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90002-CH$195
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90002-CM$195
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90002-CY$195
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(Vector de expresión)CG90002-G$75
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90002-NF$195
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90002-NH$195
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90002-NM$195
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90002-NY$195
Rhesus C-Reactive Proteína/CRP clonación del ADN o clonación génica(vector de clonación)CG90002-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is a member of the pentraxin family of proteins. The levels of CRP rise in response to inflammation. Human C-reactive protein (CRP) is the classical acute phase reactant, the circulating concentration of which rises rapidly and extensively in a cytokine-mediated response to tissue injury, infection and inflammation. Serum CRP values are routinely measured, empirically, to detect and monitor many human diseases. However, CRP is likely to have important host defence, scavenging and metabolic functions through its capacity for calcium-dependent binding to exogenous and autologous molecules containing phosphocholine (PC) and then activating the classical complement pathway. CRP may also have pathogenic effects and the recent discovery of a prognostic association between increased CRP production and coronary atherothrombotic events is of particular interest.

Referencias
  • Pepys MB. et al., 2003, J Clin Invest. 111 (12): 1805-12.
  • Thompson D. et al., 1999, Structure. 7(2): 169-77.
  • Size / Price
    Catálogo: CG90002-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"