After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus CSNK2A1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001260877.1
Tamaño de cDNA:1176bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) casein kinase 2, alpha 1 polypeptide with N terminal Flag tag.
Sinónimo de gen:CSNK2A1
Especie:Rhesus
Vector:pCMV3-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90444-ACG$225
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90444-ACR$225
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90444-ANG$225
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90444-ANR$225
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90444-CF$195
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90444-CH$195
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90444-CM$195
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90444-CY$195
Rhesus CSNK2A1 clonación del ADN o clonación génica(Vector de expresión)CG90444-G$75
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90444-NF$195
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90444-NH$195
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90444-NM$195
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90444-NY$195
Rhesus CSNK2A1 clonación del ADN o clonación génica(vector de clonación)CG90444-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Casein kinase II subunit alpha, also known as CK II alpha, CSNK2A1 and CK2A1, is a member of the protein kinase superfamily, Ser / Thr protein kinase family and CK2 subfamily. Casein kinase II (CSNK2A1) is a serine / threonine protein kinase that phosphorylates acidic proteins such as casein. This kinase is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. Casein kinase II (CSNK2A1) is a constitutively active, ubiquitously expressed serine / threonine protein kinase that is thought to have a regulatory function in cell proliferation, cell differentiation and apoptosis. CSNK2A1 functions as a tetrameric complex consisting of two regulatory beta-subunits and two catalytic units (alpha and alpha') in a homomeric or heteromeric conformation. Whilst the alpha- and alpha'-subunits are catalytically identical, proteins that regulate CSNK2A1, such as cdc2 and Hsp90, preferentially bind to the alpha and not the alpha'-subunit. CSNK2A1 can phosphorylate a number of key intracellular signaling proteins implicated in tumor suppression (p53 and PTEN) and tumorigenesis (myc, jun, NF-kappaB). CSNK2A1 is also thought to influence Wnt signaling via beta-catenin phosphorylation and the PI 3-K signaling pathway via th phosphorylation of Akt.

Referencias
  • Schlpfer J, et al. (1997) A radiation hybrid framework map of bovine chromosome 13. Chromosome Res. 5(8): 511-9.
  • Wirkner U, et al. (1994) The human gene (CSNK2A1) coding for the casein kinase II subunit alpha is located on chromosome 20 and contains tandemly arranged Alu repeats. Genomics. 19(2): 257-65.
  • Wirkner U, et al. (1998) Genomic organization and promoter identification of the human protein kinase CK2 catalytic subunit alpha (CSNK2A1). Genomics. 48(1): 71-8.
  • Size / Price
    Catálogo: CG90444-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"