Pedido rápido

Text Size:AAA

Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus DHX16 Información de producto de clon de cDNA
Tamaño de cDNA:3135bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) DEAH (Asp-Glu-Ala-His) box polypeptide 16 with C terminal His tag.
Sinónimo de gen:DHX16
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90348-ACG$325
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90348-ACR$325
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90348-ANG$325
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90348-ANR$325
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90348-CF$295
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90348-CH$295
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90348-CM$295
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90348-CY$295
Cangrejero DHX16 clonación del ADN o clonación génica(Vector de expresión)CG90348-G$75
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90348-NF$295
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90348-NH$295
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90348-NM$295
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90348-NY$295
Cangrejero DHX16 clonación del ADN o clonación génica(vector de clonación)CG90348-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90348-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.