After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Cynomolgus monkey DOCK10 ORF mammalian expression plasmid, C-His tag

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus DOCK10 Información de producto de clon de cDNA
Gene_bank_ref_id:AB056820.1
Tamaño de cDNA:1335bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) dedicator of cytokinesis 10 with C terminal His tag.
Sinónimo de gen:DOCK10
Especie:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catálogo: CG90817-CH
Precio de lista:   (Save )
Precio:      [How to order]
Disponibilidad2-3 weeksInstrucciones de envío
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"