Pedido rápido

Rhesus DPP4 / CD26 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus DPP4 Información de producto de clon de cDNA
Tamaño de cDNA:2301bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) dipeptidyl-peptidase 4 with C terminal Flag tag.
Sinónimo de gen:DPP4
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types. It is also present in serum and other body fluids in a truncated form (sCD26/DPPIV). The soluble CD26 (sCD26) as a tumour marker for the detection of colorectal cancer (CRC) and advanced adenomas. As both a regulatory enzyme and a signalling factor, DPP4 has been evaluated and described in many studies. DPP4 inhibition results in increased blood concentration of the incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP). This causes an increase in glucose-dependent stimulation, resulting in a lowering of blood glucose levels. Recent studies have shown that DPP4 inhibitors can induce a significant reduction in glycosylated haemoglobin (HbA(1c)) levels, either as monotherapy or as a combination with other antidiabetic agents. Research has also demonstrated that DPP4 inhibitors portray a very low risk of hypoglycaemia development, and are a new pharmacological class of drugs for treating Type 2 diabetes.

  • Doupis J, et al. (2008) DPP4 inhibitors: a new approach in diabetes treatment. Adv Ther. 25(7): 627-43.
  • Havre PA, et al. (2008) The role of CD26/dipeptidyl peptidase IV in cancer. Front Biosci. 13: 1634-45.
  • De Chiara L, et al. (2009) Soluble CD26 levels and its association to epidemiologic parameters in a sample population. Dis Markers. 7(6): 311-6.
  • Matteucci E, et al. (2009) Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem. 16(23): 2943-51.
  • Size / Price
    Catálogo: CG90180-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.