Pedido rápido

Text Size:AAA

Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus ECH1 Información de producto de clon de cDNA
Tamaño de cDNA:963bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) enoyl CoA hydratase 1, peroxisomal with C terminal Myc tag.
Sinónimo de gen:ECH1
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90439-ACG$225
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90439-ACR$225
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90439-ANG$225
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90439-ANR$225
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90439-CF$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90439-CH$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90439-CM$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90439-CY$195
Cangrejero ECH1 clonación del ADN o clonación génica(Vector de expresión)CG90439-G$75
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90439-NF$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90439-NH$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90439-NM$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90439-NY$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación)CG90439-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

ECH1 is a member of the hydratase/isomerase superfamily. ECH1 shows high sequence similarity to enoyl-CoA hydratases of several species, particularly within a conserved domain characteristic of these proteins. ECH1 contains a C-terminal peroxisomal targeting sequence and localizes to peroxisomes. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans, 5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. ECH1 functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators.

  • Kovalyov LI, et al. (2006) Polymorphism of delta3,5-delta2,4-dienoyl-coenzyme A isomerase (the ECH1 gene product protein) in human striated muscle tissue. Biochemistry Mosc. 71(4): 448-53.
  • Olsen JV, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 127(3):635-48.
  • FitzPatrick DR, et al. (1995) Isolation and characterization of rat and human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase. Genomics. 27(3):457-66.
  • Size / Price
    Catálogo: CG90439-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.