After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus ECH1 Información de producto de clon de cDNA
Tamaño de cDNA:963bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) enoyl CoA hydratase 1, peroxisomal with N terminal Flag tag.
Sinónimo de gen:ECH1
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90439-ACG$225
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90439-ACR$225
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90439-ANG$225
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90439-ANR$225
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90439-CF$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90439-CH$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90439-CM$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90439-CY$195
Cangrejero ECH1 clonación del ADN o clonación génica(Vector de expresión)CG90439-G$75
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90439-NF$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90439-NH$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90439-NM$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90439-NY$195
Cangrejero ECH1 clonación del ADN o clonación génica(vector de clonación)CG90439-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

ECH1 is a member of the hydratase/isomerase superfamily. ECH1 shows high sequence similarity to enoyl-CoA hydratases of several species, particularly within a conserved domain characteristic of these proteins. ECH1 contains a C-terminal peroxisomal targeting sequence and localizes to peroxisomes. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans, 5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. ECH1 functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators.

  • Kovalyov LI, et al. (2006) Polymorphism of delta3,5-delta2,4-dienoyl-coenzyme A isomerase (the ECH1 gene product protein) in human striated muscle tissue. Biochemistry Mosc. 71(4): 448-53.
  • Olsen JV, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 127(3):635-48.
  • FitzPatrick DR, et al. (1995) Isolation and characterization of rat and human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase. Genomics. 27(3):457-66.
  • Size / Price
    Catálogo: CG90439-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.