After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus EEF1B2 Información de producto de clon de cDNA
Tamaño de cDNA:678bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) eukaryotic translation elongation factor 1 beta 2 with N terminal Flag tag.
Sinónimo de gen:EEF1B2
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90457-ACG$225
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90457-ACR$225
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90457-ANG$225
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90457-ANR$225
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90457-CF$195
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90457-CH$195
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90457-CM$195
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90457-CY$195
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(Vector de expresión)CG90457-G$75
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90457-NF$195
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90457-NH$195
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90457-NM$195
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90457-NY$195
Cangrejero EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación)CG90457-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Catálogo: CG90457-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.