Pedido rápido

Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero EIF1AX Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001261777.1
    Tamaño de cDNA:435bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) eukaryotic translation initiation factor 1A, X-linked with N terminal Myc tag.
    Sinónimo de gen:EIF1AY
    Especie:Rhesus
    Vector:pCMV3-N-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90658-ACG$225
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90658-ACR$225
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90658-ANG$225
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90658-ANR$225
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90658-CF$195
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90658-CH$195
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90658-CM$195
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90658-CY$195
    Rhesus EIF1AX clonación del ADN o clonación génica(Vector de expresión)CG90658-G$75
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90658-NF$195
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90658-NH$195
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90658-NM$195
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90658-NY$195
    Rhesus EIF1AX clonación del ADN o clonación génica(vector de clonación)CG90658-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"