Pedido rápido

Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero ENO1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001195611.1
    Tamaño de cDNA:1305bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
    Sinónimo de gen:ENO1
    Especie:Rhesus
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90355-ACG$225
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90355-ACR$225
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90355-ANG$225
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90355-ANR$225
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90355-CF$195
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90355-CH$195
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90355-CM$195
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90355-CY$195
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(Vector de expresión)CG90355-G$75
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90355-NF$195
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90355-NH$195
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90355-NM$195
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90355-NY$195
    Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación)CG90355-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Referencias
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"