After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus ENO1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001195611.1
Tamaño de cDNA:1305bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
Sinónimo de gen:ENO1
Especie:Rhesus
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90355-ACG$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90355-ACR$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90355-ANG$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90355-ANR$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90355-CF$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90355-CH$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90355-CM$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90355-CY$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(Vector de expresión)CG90355-G$75
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90355-NF$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90355-NH$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90355-NM$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90355-NY$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonación del ADN o clonación génica(vector de clonación)CG90355-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Referencias
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Catálogo: CG90355-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"