Aminopeptidase A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Price:
Size:
Number:

Aminopeptidase A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
2874 bp
Description
Full length Clone DNA of Rhesus glutamyl aminopeptidase (aminopeptidase A) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Aminopeptidase A Background Information

ENPEP, also known as aminopeptidase A, is a member of the peptidase M1 family. Members of this family are involved in response to cadmium ion and proteolysis. They located in 6 components and are expressed in 26 plant structures. ENPEP is expressed by epithelial cells of the proximal tubule cells and the glomerulus of the nephron. It also can be detected in a variety of other tissues. ENPEP probably plays a role in regulating growth and differentiation of early B-lineage cells. It also may play a role in the catabolic pathway of the renin-angiotensin system. ENPEP is a zinc-dependent membrane-bound aminopeptidase that catalyzes the cleavage of glutamatic and aspartatic amino acid residues from the N-terminus of polypeptides. It degrades vasoconstricting angiotensin II into angiotensin III and therefore helps to regulate blood pressure.
Full Name
glutamyl aminopeptidase
References
  • Speth RC, et al. (2008) The significance of brain aminopeptidases in the regulation of the actions of angiotensin peptides in the brain. Heart Fail Rev. 13(3):299-309.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Pérez I, et al. (2009) Increased APN/CD13 and acid aminopeptidase activities in head and neck squamous cell carcinoma. Head Neck. 31(10):1335-40.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait