After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus FBXO44 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005544792.1
Tamaño de cDNA:675bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) F-box protein 44.
Sinónimo de gen:FBXO44
Especie:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación) on other vectors
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90724-ACG$225
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90724-ACR$225
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90724-ANG$225
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90724-ANR$225
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90724-CF$195
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90724-CH$195
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90724-CM$195
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90724-CY$195
Cangrejero FBXO44 clonación del ADN o clonación génica(Vector de expresión)CG90724-G$75
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90724-NF$195
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90724-NH$195
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90724-NM$195
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90724-NY$195
Cangrejero FBXO44 clonación del ADN o clonación génica(vector de clonación)CG90724-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90724-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"