Pedido rápido

Rhesus CD16/Fc gamma RIII clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero FCGR3 Información de producto de clon de cDNA
    Tamaño de cDNA:765bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) Fc gamma RIIIa with N terminal Myc tag.
    Sinónimo de gen:FCGR3, FcRIII
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Rhesus CD16/Fc gamma RIII clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Product nameProduct name

    Fc receptors bind the most common class of antibody, IgG, are called Fc gamma receptors (FcγR). FcγR is divided into three classes, Fc γ RI (CD64), Fc γ RII (CD32), and Fc γ RIII (CD16). CD16 protein is a multifunctional, low/intermediate affinity receptor, which belongs to the immunoglobulin superfamily. It is found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. Mouse CD16 is encoded by a single gene, while, human CD16 is expressed as two distinct forms (CD16a/FcγRIIIa and CD16b/FcγRIIIb) encoded by two different highly homologous genes in a cell type-specific manner. CD16 is involved in phagocytosis, secretion of enzymes, inflammatory mediators, antibody-dependent cellular cytotoxicity (ADCC), and clearance of immune complexes.

  • Edberg JC, et al. (2002) Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
  • Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
  • Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.
  • Size / Price
    Catálogo: CG90013-NM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.