Pedido rápido

Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus FGF12 Información de producto de clon de cDNA
Tamaño de cDNA:732bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) fibroblast growth factor 12 with C terminal Myc tag.
Sinónimo de gen:FGF12
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90074-ACG$225
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90074-ACR$225
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90074-ANG$225
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90074-ANR$225
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90074-CF$195
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90074-CH$195
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90074-CM$195
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90074-CY$195
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(Vector de expresión)CG90074-G$75
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90074-NF$195
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90074-NH$195
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90074-NM$195
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90074-NY$195
Rhesus FGF12 / FGF-12 clonación del ADN o clonación génica(vector de clonación)CG90074-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • Size / Price
    Catálogo: CG90074-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.