Pedido rápido

Text Size:AAA

Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus GAPDH Información de producto de clon de cDNA
Tamaño de cDNA:1008bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) glyceraldehyde-3-phosphate dehydrogenase with C terminal Myc tag.
Sinónimo de gen:GAPDH
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90448-ACG$225
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90448-ACR$225
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90448-ANG$225
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90448-ANR$225
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90448-CF$195
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90448-CH$195
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90448-CM$195
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90448-CY$195
Cangrejero GAPDH clonación del ADN o clonación génica(Vector de expresión)CG90448-G$75
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90448-NF$195
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90448-NH$195
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90448-NM$195
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90448-NY$195
Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación)CG90448-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
  • Size / Price
    Catálogo: CG90448-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.