Pedido rápido

Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero GAPDH Información de producto de clon de cDNA
    Gene_bank_ref_id:XM_005569912.1
    Tamaño de cDNA:1008bp
    Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) glyceraldehyde-3-phosphate dehydrogenase with C terminal Myc tag.
    Sinónimo de gen:GAPDH
    Especie:Cynomolgus
    Vector:pCMV3-C-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90448-ACG$225
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90448-ACR$225
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90448-ANG$225
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90448-ANR$225
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90448-CF$195
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90448-CH$195
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90448-CM$195
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90448-CY$195
    Cangrejero GAPDH clonación del ADN o clonación génica(Vector de expresión)CG90448-G$75
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90448-NF$195
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90448-NH$195
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90448-NM$195
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90448-NY$195
    Cangrejero GAPDH clonación del ADN o clonación génica(vector de clonación)CG90448-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

    Referencias
  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
  • Size / Price
    Catálogo: CG90448-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"