Pedido rápido

Text Size:AAA

Rhesus GGCT clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus GGCT Información de producto de clon de cDNA
Tamaño de cDNA:567bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) gamma-glutamylcyclotransferase with N terminal His tag.
Sinónimo de gen:GGCT
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Rhesus GGCT clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name

GGCT belongs to the gamma-glutamylcyclotransferase family. It catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism. GGCT may play a significant role in glutathione homeostasis. GGCT also induces release of cytochrome c from mitochondria with resultant induction of apoptosis. Pseudogenes of GGCT gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

  • Wagner SA. et al., 2011, Mol Cell Proteomics. 10 (10): M111.013284.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Amano T. et al., 2012, J Histochem Cytochem. 60 (1): 76-86.
  • Size / Price
    Catálogo: CG90618-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.