After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus GOLGA7 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001194104.1
Tamaño de cDNA:414bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) golgin A7 with C terminal His tag.
Sinónimo de gen:GOLGA7
Especie:Rhesus
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90362-ACG$225
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90362-ACR$225
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90362-ANG$225
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90362-ANR$225
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90362-CF$195
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90362-CH$195
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90362-CM$195
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90362-CY$195
Rhesus GOLGA7 clonación del ADN o clonación génica(Vector de expresión)CG90362-G$75
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90362-NF$195
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90362-NH$195
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90362-NM$195
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90362-NY$195
Rhesus GOLGA7 clonación del ADN o clonación génica(vector de clonación)CG90362-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90362-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"