After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus GOT1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001284930.1
Tamaño de cDNA:1242bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Aspartate aminotransferase, cytoplasmic with N terminal Myc tag.
Sinónimo de gen:cCAT, cAspAT
Especie:Cynomolgus
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90649-ACG$225
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90649-ACR$225
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90649-ANG$225
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90649-ANR$225
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90649-CF$195
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90649-CH$195
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90649-CM$195
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90649-CY$195
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(Vector de expresión)CG90649-G$75
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90649-NF$195
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90649-NH$195
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90649-NM$195
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90649-NY$195
Cangrejero Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación)CG90649-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

Referencias
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catálogo: CG90649-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"