Pedido rápido

Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rhesus IFNG Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001032905.1
    Tamaño de cDNA:498bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interferon-gamma with N terminal Myc tag.
    Sinónimo de gen:IFN-gamma, IFNG
    Especie:Rhesus
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90008-ACG$225
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90008-ACR$225
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90008-CF$195
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90008-CH$195
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90008-CM$195
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90008-CY$195
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(Vector de expresión)CG90008-M$75
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90008-NF$195
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90008-NH$195
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90008-NM$195
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90008-NY$195
    Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación)CG90008-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referencias
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Catálogo: CG90008-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"