Pedido rápido

Text Size:AAA

Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus IFNG Información de producto de clon de cDNA
Tamaño de cDNA:498bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interferon-gamma with N terminal Myc tag.
Sinónimo de gen:IFN-gamma, IFNG
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90008-ACG$225
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90008-ACR$225
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90008-CF$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90008-CH$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90008-CM$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90008-CY$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(Vector de expresión)CG90008-M$75
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90008-NF$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90008-NH$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90008-NM$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90008-NY$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación)CG90008-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Catálogo: CG90008-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.