After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cangrejero IGSF8 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus IGSF8 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005541281.1
Tamaño de cDNA:1845bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) immunoglobulin superfamily, member 8.
Sinónimo de gen:IGSF8
Especie:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Referencias
  • Glazar AI, et al. (2009) Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: evidence of distinct functions for CD9 and a CD9-associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 21(2): 293-303.
  • Murdoch JN, et al. (2003) Genomic organization and embryonic expression of Igsf8, an immunoglobulin superfamily member implicated in development of the nervous system and organ epithelia. Mol Cell Neurosci. 22(1): 62-74.
  • Zhang XA, et al. (2003) EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63 (10): 2665-74.
  • Size / Price
    Catálogo: CG90732-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"