Pedido rápido

Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus IL18 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001032834.2
Tamaño de cDNA:582bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin 18 (interferon-gamma-inducing factor) with N terminal Myc tag.
Sinónimo de gen:IL18
Especie:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90011-ACG$225
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90011-ACR$225
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90011-CF$195
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90011-CH$195
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90011-CM$195
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90011-CY$195
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(Vector de expresión)CG90011-M$75
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90011-NF$195
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90011-NH$195
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90011-NM$195
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90011-NY$195
Rhesus IL18/IL-18/Interleukin 18 clonación del ADN o clonación génica(vector de clonación)CG90011-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Interleukin-18 (IL-18, also known as interferon-gamma inducing factor) is a proinflammatory cytokine that belongs to the IL-1 superfamily and is produced by macrophages and other cells. This cytokine can induce the IFN-gamma production of T cells. The combination of IL-18 and IL12 has been shown to inhibit IL4 dependent IgE and IgG1 production, and enhance IgG2a production of B cells. IL-18 binding protein (IL18BP) can specifically interact with this cytokine, and thus negatively regulate its biological activity. IL-18 is an IL-1−like cytokine that requires cleavage with caspase-1 to become active, was found to increase IgE production in a CD4+ T cells-, IL-4− and STAT6−dependent fashion. IL-18 and T cell receptor−mediated stimulation could induce naïve CD4+ T cells to develop into IL-4−producing cells in vitro. Thus, caspase-1 and IL-18 may be critical in regulation of IgE production in vivo, providing a potential therapeutic target for allergic disorders. IL-18 production in primary synovial cultures and purified synovial fibroblasts was, in turn, upregulated by TNF-α and IL-1β, suggesting that monokine expression can feed back to promote Th1 cell development in synovial membrane. Besides, synergistic combinations of IL-18, IL-12, and IL-15 may be of importance in sustaining both Th1 responses and monokine production in RA.

Referencias
  • Dinarello CA. (1999) IL-18: A TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J Allergy Clin Immunol. 103: 11-24.
  • Takeda K, et al.. (1998) Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity. 8(3): 383-90.
  • Gracie JA, et al.. (1999) A proinflammatory role for IL-18 in rheumatoid arthritis. J Clin Invest. 104(10): 1393-401.
  • Size / Price
    Catálogo: CG90011-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"