Pedido rápido

Text Size:AAA

Rhesus Layilin / LAYN clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus LAYN Información de producto de clon de cDNA
Tamaño de cDNA:1125bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) layilin with C terminal Flag tag.
Sinónimo de gen:LAYN
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rhesus Layilin / LAYN clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Product nameProduct name

Layilin, a recently characterized as a 55 kDa transmembrane protein with homology to C-type lectins, is present in numerous cell lines and tissue extracts. As one of the adaptor proteins, talin mediates the interactions between the actin filaments and the cell membrane by binding to integral membrane proteins and to the cytoskeleton. Layilin is a newly identified membrane-binding site for talin in peripheral ruffles of spreading cells, a ten-amino acid motif in the layilin cytoplasmic domain is sufficient for talin binding, and its adjacent LH2-LH3 tandem arrays in the cytoplasmic domain provide docking sites for talin. Furthermore, talin binds layilin, PIPK1gamma and integrins in similar although subtly different ways. Layilin binds specifically to hyaluronan (HA) through its extracellular domain, a ubiquitous extracellular matrix component in most animal tissues and body fluids, but not to other tested glycosaminoglycans. The research suggests that layilin may mediate signals from extracellular matrix to the cell cytoskeleton via interaction with different intracellular binding partners and thereby be involved in the modulation of cortical structures in the cell. All the above actions reveal an interesting parallel between layilin and the known HA receptor CD44. In addition, merlin and radixin have been identified as different intracellular binding partners of layilin. Accordingly, it has been suggested that layilin plays roles in a variety of cellular processes, including cell shape, adhesion, motility, and homeostasis, as well as signal transduction. In addition, layilin might play an important role in the process of invasion and lymphatic metastasis of lung carcinoma.

  • Borowsky ML, et al. (1998) Layilin, a novel talin-binding transmembrane protein homologous with C-type lectins, is localized in membrane ruffles.J Cell Biol. 143(2):429-42.
  • Bono P, et al. (2001) Layilin, a novel integral membrane protein, is a hyaluronan receptor. Mol Biol Cell. 12(4)891-900.
  • Bono P, et al. (2005) Layilin, a cell surface hyaluronan receptor, interacts with merlin and radixin. Exp Cell Res. 308(1):177-87.
  • Scoles DR. (2007) The merlin interacting proteins reveal multiple targets for NF2 therapy. Biochim Biophys Acta. 1785(1):32-54.
  • Chen Z, et al. (2008) Down-regulation of layilin, a novel hyaluronan receptor, via RNA interference, inhibits invasion and lymphatic metastasis of human lung A549 cells. Biotechnol Appl Biochem. 50(Pt 2):89-96.
  • Wegener KL, et al. (2008) Structural basis for the interaction between the cytoplasmic domain of the hyaluronate receptor layilin and the talin F3 subdomain. J Mol Biol. 382(1):112-26.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.