Pedido rápido

Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus LOC100426406 Información de producto de clon de cDNA
Tamaño de cDNA:657bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) glutathione S-transferase Mu 5-like with N terminal His tag.
Sinónimo de gen:LOC100426406
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90621-ACG$225
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90621-ACR$225
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90621-ANG$225
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90621-ANR$225
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90621-CF$195
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90621-CH$195
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90621-CM$195
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90621-CY$195
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(Vector de expresión)CG90621-G$75
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90621-NF$195
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90621-NH$195
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90621-NM$195
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90621-NY$195
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación)CG90621-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.