Pedido rápido

Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rhesus LOC100426406 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_002801692.1
Tamaño de cDNA:657bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) glutathione S-transferase Mu 5-like with N terminal His tag.
Sinónimo de gen:LOC100426406
Especie:Rhesus
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90621-ACG$325
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90621-ACR$325
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90621-ANG$325
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90621-ANR$325
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90621-CF$295
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90621-CH$295
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90621-CM$295
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90621-CY$295
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(Vector de expresión)CG90621-G$75
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90621-NF$295
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90621-NH$295
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90621-NM$295
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90621-NY$295
Rhesus glutathione S-transferase Mu 5-like clonación del ADN o clonación génica(vector de clonación)CG90621-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90621-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"