Pedido rápido

Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus LOC100428624 Información de producto de clon de cDNA
Tamaño de cDNA:141bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100428624 with C terminal His tag.
Sinónimo de gen:LOC100428624
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90363-ACG$225
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90363-ACR$225
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90363-ANG$225
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90363-ANR$225
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90363-CF$195
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90363-CH$195
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90363-CM$195
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90363-CY$195
Rhesus LOC100428624 clonación del ADN o clonación génica(Vector de expresión)CG90363-G$75
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90363-NF$195
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90363-NH$195
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90363-NM$195
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90363-NY$195
Rhesus LOC100428624 clonación del ADN o clonación génica(vector de clonación)CG90363-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90363-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.