After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus LOC101865064 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001283855.1
Tamaño de cDNA:480bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) hypothetical protein.
Sinónimo de gen:LOC101865064
Especie:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación) on other vectors
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90718-ACG$225
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90718-ACR$225
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90718-ANG$225
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90718-ANR$225
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90718-CF$195
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90718-CH$195
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90718-CM$195
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90718-CY$195
Cangrejero LOC101865064 clonación del ADN o clonación génica(Vector de expresión)CG90718-G$75
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90718-NF$195
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90718-NH$195
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90718-NM$195
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90718-NY$195
Cangrejero LOC101865064 clonación del ADN o clonación génica(vector de clonación)CG90718-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90718-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"