Pedido rápido

Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus LOC101866917 Información de producto de clon de cDNA
Tamaño de cDNA:1413bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866917 with N terminal His tag.
Sinónimo de gen:LOC101866917
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90596-ACG$225
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90596-ACR$225
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90596-ANG$225
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90596-ANR$225
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90596-CF$195
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90596-CH$195
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90596-CM$195
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90596-CY$195
Cangrejero LOC101866917 clonación del ADN o clonación génica(Vector de expresión)CG90596-G$75
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90596-NF$195
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90596-NH$195
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90596-NM$195
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90596-NY$195
Cangrejero LOC101866917 clonación del ADN o clonación génica(vector de clonación)CG90596-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90596-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.