After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus LOC101867163 Información de producto de clon de cDNA
Gene_bank_ref_id:AB172067.1
Tamaño de cDNA:261bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101867163 with C terminal His tag.
Sinónimo de gen:LOC101867163
Especie:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90832-ACG$225
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90832-ACR$225
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90832-ANG$225
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90832-ANR$225
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90832-CF$195
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90832-CH$195
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90832-CM$195
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90832-CY$195
Cangrejero LOC101867163 clonación del ADN o clonación génica(Vector de expresión)CG90832-G$75
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90832-NF$195
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90832-NH$195
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90832-NM$195
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90832-NY$195
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación)CG90832-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90832-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"