Pedido rápido

Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cangrejero LOC101867163 Información de producto de clon de cDNA
Gene_bank_ref_id:AB172067.1
Tamaño de cDNA:261bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101867163 with C terminal His tag.
Sinónimo de gen:LOC101867163
Especie:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90832-ACG$325
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90832-ACR$325
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90832-ANG$325
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90832-ANR$325
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90832-CF$295
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90832-CH$295
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90832-CM$295
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90832-CY$295
Cangrejero LOC101867163 clonación del ADN o clonación génica(Vector de expresión)CG90832-G$75
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90832-NF$295
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90832-NH$295
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90832-NM$295
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90832-NY$295
Cangrejero LOC101867163 clonación del ADN o clonación génica(vector de clonación)CG90832-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"